Skip to content

phac-nml/measeq

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

215 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

MeaSeq: Measles Sequence Analysis Automation

Current Updates

2026-05-20 Summary

Full release version 1.2.0! Pipeline supports equivalent Illumina and Nanopore workflows allowing whole genome or amplicon sequencing analysis. The MeaSeq workflow generates whole genome consensus sequences, N450 sequences and reporting information, DSId hashing and assigning, and a final QC report. It can be run with a single reference or with the genotyping predictions and a config setup containing a users preferred references.

Changes in v1.2.0 include the addition of Bowtie 2 as an alterative read mapping tool (instead of BWAMem 2) and support for the Artic primers mapped to the pipeline's preset references (D8, B3, and A genotypes).

Preprint

If you find this pipeline useful, please cite our preprint as:

Evaluation of MeaSeq: comprehensive analysis and reporting of measles virus whole genome sequences. Darian T Hole, Ahmed Abdalla, Vanessa Zubach, Molly Pratt, Stephanie Van Driel, Samar Ashfaq, Joanne Hiebert, Ana T Duggan bioRxiv 2026.05.12.724559; doi: https://doi.org/10.64898/2026.05.12.724559

Genotype Predictions

  • Sample references are now set based on the predicted genotype with a default fallback for non-supplied genotypes or unknown/mixed samples.
    • Currently supported in the repo by default: A, B3, D8
    • Recommended users set their own references and primers
    • Users can supply their own references for other genotypes or update the current genotype ones based on their needs
    • Users can set their own whole run reference (no predictions or genotype specific analysis) with --reference
    • References Config
    • More total information available in the References and Predictions section

Future Direction and Support

  • Updating the final report and maintaining best practices/tool updates as they are released

  • For IRIDA-Next, we're hoping to evaluate generic viral pipeline options (or create one) and merge in virus specific post-processing stages

    • So measeq post-processing would end up included there

Introduction

MeaSeq is a measles virus (MeV) specific pipeline established for use in surveillance and outbreak analysis. This pipeline utilizes a reference-based read mapping approach for Whole Genome or Amplicon sequencing data from both the Illumina and Nanopore platforms to output MeV consensus sequences (whole genome and N450), variant data, sequencing qualtiy information, and custom summary reports.

MeaSeq Workflow Diagram

This project aims to implement an open-source, easy to run, MeV Whole Genome Sequence analysis pipeline that works on both Illumina and Nanopore data. The end goal of this project is to deploy a standardized pipeline focused on final reporting metrics and plots for rapid detection and response to MeV outbreaks in Canada and abroad.

The basis of the pipeline come from three other pipelines. The Illumina side from nf-cores' Viralrecon pipeline along with Jared Simpson's SARS-CoV-2 pipeline (specficially Freebayes and VCF parsing) and for Nanopore the artic pipeline with some slight modifications to different aspects of their variant calling and filtering. Most additions were added for measles-specific QC and reporting based on lab needs at the NML.

Installation

Note

If you are new to Nextflow and nf-core, please refer to this page on how to set-up Nextflow. Make sure to test your setup with -profile test_illumina before running the workflow on actual data.

Installation requires both nextflow at a minimum version of 24.10.0 and a dependency management system to run.

Steps:

  1. Download and install nextflow

    1. Download and install with conda
      • Conda command: conda create -n nextflow -c conda-forge -c bioconda nextflow
    2. Install with the instructions at https://www.nextflow.io/
  2. Determine which dependency management system works best for you

    • Note: Currently the plotting process is using a custom docker container but it should work for both docker and singularity
  3. Run the pipeline with one of the following profiles to handle dependencies (or use your own profile) if you have one for your institution!:

    • conda
    • mamba
    • singularity
    • docker

Resources Requirements

By default, the bwamem2 step has a minimum resource usage allocation set to 12 cpus and 72GB memory using the nf-core process_high label.

This can be adjusted (along with the other labels) by creating and passing a custom configuration file with -c <config>. More info can be found in the usage doc

The pipeline has also been tested using as low as 2 cpus and 8GB memory with a few throttling steps but functional.

Usage

Illumina

First, prepare a samplesheet with your input data that looks as follows for Illumina paired-end data:

samplesheet.csv:

sample,fastq_1,fastq_2
MeVSample01,/PATH/TO/inputread1_S1_L002_R1_001.fastq.gz,/PATH/TO/inputread1_S1_L002_R2_001.fastq.gz
PosCtrl01,/PATH/TO/inputread2_S1_L003_R1_001.fastq.gz,/PATH/TO/inputread2_S1_L003_R2_001.fastq.gz
Sample3,/PATH/TO/inputread3_S1_L004_R1_001.fastq.gz,/PATH/TO/inputread3_S1_L004_R2_001.fastq.gz

Each row represents a sample and its associated paired-end Illumina read data.

You can then run the pipeline using:

nextflow run phac-nml/measeq \
    -profile <docker/singularity/.../institute>
    --input <SAMPLESHEET> \
    --outdir <OUTDIR> \
    --platform illumina \

Nanopore

And as follows for nanopore data:

samplesheet.csv

sample,fastq_1,fastq_2
MeVSample01,/PATH/TO/inputread1.fastq.gz,
PosCtrl01,/PATH/TO/inputread2.fastq.gz,
Sample3,/PATH/TO/inputread3.fastq.gz,

Each row represents a sample and its single-end nanopore data.

You can then run the pipeline using:

nextflow run phac-nml/measeq \
    --input <SAMPLESHEET> \
    --outdir <OUTDIR> \
    --platform nanopore \
    --model <CLAIR3_MODEL> \
    -profile <docker/singularity/institute/etc>

Clair3 Models

The Nanopore pipeline utilizes Clair3 to call nanopore variants which requires a model that should be picked based off of the flowcell, pore, translocation speed, and basecalling model.

Some models are built into clair3 and some need to be downloaded. The pre-trained clair3 models are able to be automatically downloaded when running the pipeline using artic get_models and can be specified as a parameter with --model <MODEL>.

Additional or local models can also be used, you just have to provide a path to them and use the --local_model <PATH> parameter instead

Variant Quality Filtering and Masking Mixed Sites

In addition to calling variants with Clair3, the Nanopore pipeline will mask sites that are of lower quality (Default: 2 < QUAL < 7) or have a non-consensus level allele frequency (Default: 30% < AF < 60%) with an N in the final consensus. These masked sites can be found in the final HTML report or under the results/vcf/artic/<sample>.fail.vcf file.

To adjust this behaviour, you can set the --min_variant_qual_c3, --min_allele_freq_c3, and --min_mask_freq_c3 parameters. Setting them all to 0 will essentially turn off variant filtering other than for indels and low depth sites and will then instead rely solely on clair3's calls.

Reference Assignment

With MeaSeq v0.5.0 and later, the --reference parameter is no longer required. Instead, the pipeline now runs on a per-sample reference assignment based on predicting the input sample's most likely genotype. In doing so, we have preset 3 reference files based on three measles virus genotypes (B3, D8, A). If a sample is predicted to be one of these genotypes, then the pipeline processes the sample using the corresponding reference FASTA file. If the sample's most likely genotype doesn't correspond to one of these genotypes, then the pipeline defaults to the set --default_ref reference FASTA file which matches the D8 reference genome by default.

It is highly recommended that users evaluate and setup their own reference sequences and especially primer files when running with predictions as they may differ from what is provided by default (which are internally used references and primers). This should only need to be done once and then the setup can be used for subsequent runs. Instructions are available to set this up.

Specifying Singular Reference

Users can turn off reference prediction and instead run all samples with their own reference genome using the --reference <FASTA> parameter.

Changing the Preset References and Primer Files

Evalutating and adjusting the preset reference genomes and primer bed files is recommended; especially the primers files if running with amplicon data. To make these adjustments, you can pass a -params-file or use the command line to specify genotype reference or primer bed files to change. More detailed information about changing the preset files is found within the usage file.

Amplicons and Primer Files

Both Illumina and Nanopore support running amplicon data using a primer bed file to trim primer positions with either iVar or ARTIC. To run amplicon data when running with genotype predictions, specify the --amplicon parameter and the primer file associated with the predicted genotype will be used to trim the reads.

If running the pipeline with your own reference using --reference <FASTA>, you have to specify your own primer bed file with --primer_bed <PRIMER_BED> to run amplicon data. The primer bed file details the location of where the primers map to in the reference genome. An example primer bed file looks as such:

primer.bed

<CHROM>         <START> <END>   <PRIMER_NAME>   <POOL>  <DIRECTION>
MH356245.1      1       25      MSV_1_LEFT      1       +
MH356245.1      400     425     MSV_2_LEFT      2       +
MH356245.1      500     525     MSV_1_RIGHT     1       -
MH356245.1      900     925     MSV_2_RIGHT     2       -

To properly pair the primers, make sure that the names match up until the _LEFT or _RIGHT that mark the primer direction in the primer name. You can also use the following direction extensions in pairing:

  • _LEFT and _RIGHT
  • _L and _R
  • _FORWARD and _REVERSE
  • _F and _R

Note: The first line in the example file is just to display what each line expects and should not be included when creating a primer bed file

DSIds

While 24 MeV genotypes were initially identified, only 2 have been detected since 2021: B3 and D8. Due to this, the Distinct Sequence Identifier (DSId) system was created to designate a unique 4-digit identifier based on the precise N450 sequence as a sub-genotype nomenclature. The Measles Nucleotide Surveillance database (MeaNS) is the global resource for these measles virus genetic sequences that is maintained by the WHO. N450 sequences can be submitted to the database to generate a distinct sequence identifier (DSId) for each unique sequence.

There is no way to query the current database so a multifasta file with DSId calls is required to match them up locally. If a match is found, the matching DSId is assigned! If no match is found, the distinct sequence is given a Novel-<MD5 HASH> (first 7 characters) identifier so that it can be submitted to the database. To do this, use the parameter --dsid_fasta <FASTA> with the fasta file structured to look as such:

dsid_fasta

>1931 D8
GTCAGTTCCACATTGGCATCTGAACTCG
> 2001 D8
GTCAGTTCCACATTGGCATCAGAACTCG
> 2418 B3
GTCAGTTCCACAGTGGCATCTGAACTCG

If no DSId FASTA file is given, the DSIds will still be generated as hashes to group up samples in the dsid.tsv file and in the final report.

Contact Information

Users have the option of including their contact information on the final report of the pipeline to easily allow for the sharing of the report. Information for how to set up and add contact information is provided in the usage document.

More Run Options

For more detailed running options including adding metadata, adjusting parameters, adding in DSID matches, and more, please refer to the usage docs.

Warning

Please provide pipeline parameters via the CLI or Nextflow -params-file option. Custom config files including those provided by the -c Nextflow option can be used to provide any configuration except for parameters; see docs.

Testing

To test the MeaSeq pipeline, and that everything works on your system, a small set of illumina D8 genotype samples have been included from SRA BioProject PRJNA480551 in the test_data/fastqs directory.

To run the pipeline on these samples run the following command:

nextflow run phac-nml/measeq -profile test_illumina,<docker/singularity/institute/etc>

Outputs

The main outputs of the pipeline are the consensus sequences (N450 and Full), the overall.qc.csv summary table, and the MeaSeq_Report.html. The final MeaSeq report gives a summary of the run including sample quality metrics, plots, and any additional information. Detailed pipeline outputs are described within the output docs

Steps

More detailed steps are available in the output docs

Illumina Steps

  1. Generate Reference and Primer Intermediates
  2. FastQC
  3. Illumina Consensus Workflow
    1. FastP
    2. BWAMem2
    3. iVar Trim (Amplicon input only)
    4. Picard MarkDuplicates (if parameter given to run)
    5. Freebayes
    6. Process Freebayes VCF
    7. Make Depth Mask
    8. Bcftools Consensus (Ambiguous and Consensus variants)
  4. Nextclade (N450 and Custom datasets, N450 fasta output)
  5. Samtools depth
  6. Compare DSId (Optional with --dsid_fasta parameter)
  7. Make sample QC
  8. Amplicon Summary Workflow (Amp only data)
    1. Bedtools Coverage
    2. Summarize Amplicon Depth
    3. Summarize Amplicon Completeness
    4. MultiQC Amplicon Report
  9. Report Workflow
    1. Samtools mpileup
    2. Pysamstats
    3. Rmarkdown

Nanopore Steps

  1. Generate Reference and Primer Intermediates
  2. FastQC
  3. Nanopore Consensus Workflow
    1. Artic Get Models
    2. NanoQ
    3. Minimap2
    4. Amplicon
      1. Artic Align Trim
      2. Clair3 Pool
      3. Artic VCF Merge
    5. Clair3 No Pool (non-amplicon)
    6. Make Depth Mask
    7. VCF Filter
    8. Artic Mask
    9. Bcftools Norm
    10. Bcftools Consensus
  4. Nextclade (N450 and Custom datasets, N450 fasta output)
  5. Samtools depth
  6. Compare DSId (Optional with --dsid_fasta parameter)
  7. Make sample QC
  8. Amplicon Summary Workflow (Amp only data)
    1. Bedtools Coverage
    2. Summarize Amplicon Depth
    3. Summarize Amplicon Completeness
    4. MultiQC Amplicon Report
  9. Report Workflow
    1. Samtools mpileup
    2. Pysamstats
    3. Rmarkdown

Troubleshooting

For troubleshooting, please open an issue or consult the usage docs to see if they have the information you require.

Credits

MeaSeq was originally written as an illumina-focused bash pipeline by McMaster University Co-op student - Ahmed Abdalla and has now been expanded to cover nanopore data along with being fully converted to Nextflow.

For questions please contact either:

  • Darian Hole (darian.hole@phac-aspc.gc.ca)
  • Molly Pratt (molly.pratt@phac-aspc.gc.ca)

Citations

A citation for this pipeline will be available soon.

This pipeline uses code and infrastructure developed and maintained by the nf-core community, reused here under the MIT license.

The nf-core framework for community-curated bioinformatics pipelines.

Philip Ewels, Alexander Peltzer, Sven Fillinger, Harshil Patel, Johannes Alneberg, Andreas Wilm, Maxime Ulysse Garcia, Paolo Di Tommaso & Sven Nahnsen.

Nat Biotechnol. 2020 Feb 13. doi: 10.1038/s41587-020-0439-x. In addition, references of tools and data used in this pipeline are as follows:

Detailed citations for utilized tools are found in CITATIONS.md

Contributing

Contributions are welcome through creating PRs or Issues

Legal

Copyright 2025 Government of Canada

Licensed under the MIT License (the "License"); you may not use this work except in compliance with the License. You may obtain a copy of the License at:

https://opensource.org/license/mit/

Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License.

About

Measles Sequence Analysis and Automation

Topics

Resources

License

Stars

Watchers

Forks

Packages

 
 
 

Contributors