Skip to content

oicr-gsi/hlavbseq

Repository files navigation

hlavbseq

HLAVBSeq is software to estimate the most likely HLA types from high-throughput sequencing data.

Overview

Dependencies

Usage

Cromwell

java -jar cromwell.jar run hlavbseq.wdl --inputs inputs.json

Inputs

Required workflow parameters:

Parameter Value Description
inputBam File BWA aligned reads.
inputBai File index for BWA aligned reads.
bwaMem.runBwaMem_bwaRef String The reference genome to align the sample with by BWA
bwaMem.runBwaMem_modules String Required environment modules
bwaMem.readGroups String Complete read group header line

Optional workflow parameters:

Parameter Value Default Description
outputFileNamePrefix String "" Output prefix, customizable. Default is the first file's basename.
add_params String "-M -P -L 10000 -a" HLAVBSeq uses additional parameters for BWA which need to be specified.
filterTag Int 256 To address the issue with some data, we use 256 (secondary alignment) as a default
bwa_threads Int 8 Threads to use with BWA aligner.

Optional task parameters:

Parameter Value Default Description
extractReads.jobMemory Int 8 Memory allocated to the task.
extractReads.timeout Int 20 Timeout in hours, needed to override imposed limits.
extractReads.hlaIntervals String "chr6:29907037-29915661 chr6:31319649-31326989 chr6:31234526-31241863 chr6:32914391-32922899 chr6:32900406-32910847 chr6:32969960-32979389 chr6:32778540-32786825 chr6:33030346-33050555 chr6:33041703-33059473 chr6:32603183-32613429 chr6:32707163-32716664 chr6:32625241-32636466 chr6:32721875-32733330 chr6:32405619-32414826 chr6:32544547-32559613 chr6:32518778-32554154 chr6:32483154-32559613 chr6:30455183-30463982 chr6:29689117-29699106 chr6:29792756-29800899 chr6:29793613-29978954 chr6:29855105-29979733 chr6:29892236-29899009 chr6:30225339-30236728 chr6:31369356-31385092 chr6:31460658-31480901 chr6:29766192-29772202 chr6:32810986-32823755 chr6:32779544-32808599 chr6:29756731-29767588" Intervals where HLA-alleles are sitting
extractReads.modules String "samtools/1.9" Names and versions of required modules.
indexBam.jobMemory Int 18 Memory allocated to the task.
indexBam.overhead Int 6 Ovrerhead for calculating heap memory, difference between total and Java-allocated memory
indexBam.timeout Int 20 Timeout in hours, needed to override imposed limits.
indexBam.bamNameIndexJar String "$HLA_VBSEQ_ROOT/bin/bamNameIndex.jar" Jar file for bamNameInder
indexBam.modules String "hla-vbseq/1 hlavbseq-bwa-index/2.0" Names and versions of required modules.
makeFastq.jobMemory Int 24 Memory allocated to the task.
makeFastq.overhead Int 6 Ovrerhead for calculating heap memory, difference between total and Java-allocated memory
makeFastq.timeout Int 20 Timeout in hours, needed to override imposed limits.
makeFastq.bamNameIndexJar String "$HLA_VBSEQ_ROOT/bin/bamNameIndex.jar" Jar file for bamNameInder
makeFastq.picardParams String "VALIDATION_STRINGENCY=LENIENT" Additional parameters for picard SamToFastq, Default is VALIDATION_STRINGENCY=LENIENT
makeFastq.modules String "samtools/1.9 picard/2.21.2" Names and versions of required modules.
bwaMem.adapterTrimmingLog_timeout Int 48 Hours before task timeout
bwaMem.adapterTrimmingLog_jobMemory Int 12 Memory allocated indexing job
bwaMem.indexBam_timeout Int 48 Hours before task timeout
bwaMem.indexBam_modules String "samtools/1.9" Modules for running indexing job
bwaMem.indexBam_jobMemory Int 12 Memory allocated indexing job
bwaMem.bamMerge_timeout Int 72 Hours before task timeout
bwaMem.bamMerge_modules String "samtools/1.9" Required environment modules
bwaMem.bamMerge_jobMemory Int 32 Memory allocated indexing job
bwaMem.runBwaMem_timeout Int 96 Hours before task timeout
bwaMem.runBwaMem_jobMemory Int 32 Memory allocated for this job
bwaMem.adapterTrimming_timeout Int 48 Hours before task timeout
bwaMem.adapterTrimming_jobMemory Int 16 Memory allocated for this job
bwaMem.adapterTrimming_addParam String? None Additional cutadapt parameters
bwaMem.adapterTrimming_modules String "cutadapt/1.8.3" Required environment modules
bwaMem.slicerR2_timeout Int 48 Hours before task timeout
bwaMem.slicerR2_jobMemory Int 16 Memory allocated for this job
bwaMem.slicerR2_modules String "slicer/0.3.0" Required environment modules
bwaMem.slicerR1_timeout Int 48 Hours before task timeout
bwaMem.slicerR1_jobMemory Int 16 Memory allocated for this job
bwaMem.slicerR1_modules String "slicer/0.3.0" Required environment modules
bwaMem.countChunkSize_timeout Int 48 Hours before task timeout
bwaMem.countChunkSize_jobMemory Int 16 Memory allocated for this job
bwaMem.numChunk Int 1 number of chunks to split fastq file [1, no splitting]
bwaMem.doTrim Boolean true if true, adapters will be trimmed before alignment
bwaMem.trimMinLength Int 1 minimum length of reads to keep [1]
bwaMem.trimMinQuality Int 0 minimum quality of read ends to keep [0]
bwaMem.adapter1 String "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" adapter sequence to trim from read 1 [AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC]
bwaMem.adapter2 String "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT" adapter sequence to trim from read 2 [AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT]
filterBam.jobMemory Int 12 Memory allocated to the task.
filterBam.timeout Int 12 Timeout in hours, needed to override imposed limits.
filterBam.modules String "samtools/1.9" Names and versions of required modules.
runHlaVbSeq.jobMemory Int 32 Memory allocated to the task.
runHlaVbSeq.timeout Int 20 Timeout in hours, needed to override imposed limits.
runHlaVbSeq.overhead Int 6 Difference between memory allocated and memory used as Java heap
runHlaVbSeq.alphaZero Float 0.01 Hyperparameter, as described in the paper it is not recommended to change the default (0.01)
runHlaVbSeq.hlavbseqJar String "$HLA_VBSEQ_ROOT/bin/HLAVBSeq.jar" path to HLAVBSeq jar file
runHlaVbSeq.hlaFasta String "$HLAVBSEQ_BWA_INDEX_ROOT/hla_all_v2.fasta" fasta with HLA sequences
runHlaVbSeq.modules String "hla-vbseq/1 hlavbseq-bwa-index/2.0" Names and versions of required modules.
parseResults.jobMemory Int 8 Memory allocated to the task.
parseResults.timeout Int 20 Timeout in hours, needed to override imposed limits.
parseResults.parsingScript String "$HLA_VBSEQ_ROOT/bin/parse_result.pl" Path to the parsing script
parseResults.alleleFile String "$HLAVBSEQ_BWA_INDEX_ROOT/Allelelist.txt" File with allele information
parseResults.modules String "hla-vbseq/1 hlavbseq-bwa-index/2.0" Names and versions of required modules.
callHlaDigits.jobMemory Int 8 Memory allocated to the task.
callHlaDigits.timeout Int 20 Timeout in hours, needed to override imposed limits.
callHlaDigits.meanReadLength Int 90 Mean read length, default is 90
callHlaDigits.resolution Int 4 Resolution for HLA allele may be 4, 6 or 8
callHlaDigits.callingScript String "$HLA_VBSEQ_ROOT/bin/call_hla_digits.py" Path to the HLA allele calling script
callHlaDigits.alleleFile String "$HLAVBSEQ_BWA_INDEX_ROOT/Allelelist.txt" File with allele information
callHlaDigits.modules String "hla-vbseq/1 hlavbseq-bwa-index/2.0" Names and versions of required modules.

Outputs

Output Type Description Labels
hlaVbSeqresult File Results as they come from the tool, all HLA alleles are listed vidarr_label: hlaVbSeqresult
parsedResults File Parsed Results, HLA alleles with non-zero signal vidarr_label: parsedResults
resultsFile File File with the final HLA Allele calls vidarr_label: resultsFile

Commands

This section lists command(s) run by HLA-VBseq workflow

  • Running HLA-VBseq

At this point, workflow uses a filtering step for alignments (removing secondary hits) which is not a part of the standard way to run this tool. It may be resolved in a future, but since the authors did not publish the source code it may require direct communication with them to clarify some issues. The workflow produces reports as expected, though filtering of reads may distort the assessment of HLA alleles.

Extracting reads which overlap HLA alleles:

  samtools view INPUT_BAM HLA_INTERVALS | awk '{print $1}' | sort | uniq > [OUTPUT_PREFIX]_HLA-VBSeq_reads.txt
 

Indexing bam file with HLA-VBseq and extracting HLA reads into a .sam file

  set -euo pipefail
  unset _JAVA_OPTIONS
  mkdir data
  ln -s INPUT_BAM -t data
  java -Xmx18G -jar BAM_NAME_INDEX_JAR index data/FILE_NAME  --indexFile data/FILE_NAME.idx
  java -Xmx18G -jar BAM_NAME_INDEX_JAR search data/FILE_NAME --name HLA_READS --output [FILE_NAME]_partial.sam

Extract reads into fastq files, both for HLA-specific and unmapped reads. Merge

  set -euo pipefail
  unset _JAVA_OPTIONS
  java -Xmx24G -jar picard.jar SamToFastq I=PARTIAL_SAM F=PARTIAL_1.fastq F2=PARTIAL_2.fastq
  samtools view -bh -f 12 INPUT_BAM > [FILE_NAME].sorted_unmapped.bam
  java -Xmx24G -jar picard.jar SamToFastq I=[FILE_NAME].sorted_unmapped.bam F=UNMAPPED_1.fastq F2=UNMAPPED_2.fastq
  cat PARTIAL_1.fastq UNMAPPED_1.fastq | gzip -c > [FILE_NAME]_part_1.fastq.gz
  cat PARTIAL_2.fastq UNMAPPED_2.fastq | gzip -c > [FILE_NAME]_part_2.fastq.gz

Filter alignments (the default is to remove secondary alignments)

  samtools view -h -F FILTER_TAG INPUT_BAM -b > FILTERED_BAM

Run the analysis with HLA-VBseq, call HLA alleles

  set -euo pipefail
  unset _JAVA_OPTIONS
  java -jar -Xmx12g -Xms12g HLAVBSEQ_JAR \
                            HLA_FASTA \
                            INPUT_BAM \
                            [FILE_NAME]_HLA-VBSeq_results.txt  \
                            --alpha_zero ALPHA_ZERO \
                            --is_paired 

Parsing raw calls from HLA-VBseq

  ~{parsingScript} ALLELE_FILE \
                   RESULTS_FILE > \
                   [FILE_NAME]_HLA-VBSeq_prediction.txt

Post-processing of the results

  python3 CALLING_SCRIPT \
      -v RESULTS_FILE \
      -a ALLELE_FILE \
      -r MEAN_READ_LENGTH \
      -d RESOLUTION \
      --ispaired > \
      [FILE_NAME]_HLA-VBSeq_call.txt

Support

For support, please file an issue on the Github project or send an email to gsi@oicr.on.ca .

Generated with generate-markdown-readme (https://github.com/oicr-gsi/gsi-wdl-tools/)

About

workflow wraps HLA-VBSeq, a tool for estimating the most prevalent HLA types in a sample

Topics

Resources

License

Stars

Watchers

Forks

Packages

 
 
 

Contributors