PdifFinder

Author: Shao Mengjie; Liang Qian; Xiaoting Hua

Email: 1437819081@qq.com; norah-liang@dmicrobe.com; xiaotinghua@zju.edu.cn

Institute: Zhejiang University

This program is designed for annotation of antimicrobal resistance(AMR), pdif site and pdif-ARGs module in bacteria.

Install:

PdifFinder is a python3.X script, running on linux. You should install BLAST and add it in environment variable, you can download from https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/. BLAST version is 2.10.1 in pdifFinder.

• One: You can download from github by git clone https://github.com/mjshao06/pdifFinder.git. Then execute cd pdifFinder. Last execute pip install ..
• Two: You can install PdifFinder from PyPI by pip install PdifFinder.

Run:

PdifFinder can accept FASTA and GENBANK format file(single or multi sequences in one file). Attention on GENBANK format file, it should follow standard format. There are three input parameter, "-i" means FASTA, "-g" means GENBANK, "-d" means input dir contains FASTA or GENBANK.

• Simply, you can just run:

pdifFinder -n FASTA -o outdir
pdifFinder -g GENBANK -o outdir
pdifFinder -d inputdir -o outdir

• For more parameter, you can run:

pdifFinder -h

• Here are some import parameter:

parameter	description
--nucleotide(-n)	FASTA file
--genbank(-g)	GENBANK file
--indir(-d)	input dirname
--resultdir(-o)	output dirname
--map(-c)	output graph format,default is circle

Databases:

Here are databases structure:

  .
  ├── AMRDB
  │   ├── sequence.fasta         Resistance gene reference sequences in FASTA format
  │   │                     sequence id must be database name~~~gene~~~accession~~~description,
  │   │                     eg:  ncbi~~~1567214_ble~~~NG_047553.1~~~BLEOMYCIN BLMA family bleomycin binding protein
  │   ├── Res.nhr
  │   ├── Res.nin
  │   └── Res.nsq
  │   └── Res.ndb
  │   └── Res.not
  │   └── Res.nto
  │   └── Res.ntf
  └── data
      ├── redundant.seed.fa  Pdif site reference sequences in FASTA format
                             sequence id must be database >plasmid accession number in NCBI
                             eg: >KY984047.1_1 ACTGCGCATAAGAGATTTTATGTTAAAT
      ├── pdifdatabase.fasta ALL pdif sites from 481 plasmids
      └── genecolor.txt

Output:

filename	description
AMRgene.txt	resistance gene annotation
pdif_site.txt	pdif site annotation
pdifmodule_list.txt	pdif-ARGs module annotation
pdifmoduleseq.fasta	pdif-ARGs module sequence
pdifmodule.svg	pdif-ARGs figure
plasmid.html	circular graph for above features