This repository contains the supplemental code for the manuscript "A recombineering pipeline to clone large and complex genes in Chlamydomonas". Two sets of genome analysis tools are provided. The first is BACSearcher, a tool to facilitate easy recombineering of Chlamydomonas genes from the Chlamydomonas BAC library. The repository contains the BACSearcher python code plus two precursor files required to run the script. The second set contains short python scripts that can be used to convert or reformat output files from the bioinformatics tools Tandem Repeats Finder (Benson, 1999), WindowMasker from NCBI (Morgulis et al., 2006) and check_primers from Primer3 (Rozen and Skaletsky, 2000). Also included is a script for generating fasta sequence files and positional information for Chlamydomonas nuclear genes based on sequence data from the reference genome hosted on Phytozome. All scripts have been tested with Chlamydomonas-specific datasets and may require some editing to become more widely applicable.

1. BACSearcher

BACSearcher is a genome analysis python tool to facilitate easy recombineering of Chlamydomonas genes from BACs.

Developed by John W. Davey and Tom Emrich-Mills

Script: BACSearcher.txt written by John W. Davey

1.1. Function

BACSearcher considers all or a subset of Chlamydomonas genes and provides three key pieces of information useful for recombineering a gene of interest using the pipeline detailed in Supplementary Method 1 of the associated manuscript:

1. The script identifies up to five 50 bp regions chosen from a stretch of sequence 2000-3000 bp upstream of the annotated start codon for each gene. Regions are picked based on low GC content and absence of mono- and dinucleotide repeats. The script reports the reverse complement of each of these regions, any of which can be added to the 5’ end of the universal primer GAAGATCCTTTGATCTTTTCTACGGG to produce a target-specific cloning primer. When used in tandem with the 50 bp immediately upstream of the stop codon, prepended to the 5’ end of universal primer GGAGATCTGGGTGGCTCCG, these cloning primers can amplify a target-specific recombineering cassette from pLM099 by PCR (see Supplementary Method 1C of the associated manuscript). Instructions to modify the lengths of these regions are detailed below (see Modifications to the script).

2. The script reports four pairs of Primer3-generated checking primers for each gene, two which can amplify a short sequence from the 5’ end of the gene and two from the 3’ end. These can be used to confirm the presence of the 5’ and 3’ ends of each target gene within a BAC in the Chlamydomonas BAC library.

3. The script reports the five smallest BACs containing each gene where available. BACs are reported if they cover the region spanning from 3000 bp upstream of the gene to the stop codon. An exception is made in cases where this region extends beyond the ends of a chromosome or scaffold, in which case the region is altered so that it starts/ends at the first/last position of the chromosome/scaffold. These parameters can be modified by the user so that BACs are only reported if, for example, the BAC sequence covers a larger 5’ flanking region, or also covers the 3’UTR of the gene of interest. Instructions to make these modifications to the script are detailed below.

Two outputs are generated after each run of the script, one for BAC coverage and one for fosmid coverage of each gene. BAC and fosmid data are taken from the version 5.5 annotation of the Chlamydomonas genome. The fosmid output file contains identical information for points 1 and 2 (above), but for point 3 the BAC-specific information is replaced by fosmid-specific information. Fosmid plate/well coordinates are not provided. The BAC output for all 17,741 genes in the genome is provided in Supplemental Data Set 1 of the associated manuscript.

1.2. Specialist python modules required

BACSearcher has been tested using Python 3.6 and requires the following modules to be installed:

• Gffutils

• Interval tree

• Biopython

• Primer3-py

1.3. Example usage

BACSearcher can be initiated from the command line using the following options:

./BACSearcher.py -p BACs_fosmids.pairs.tsv -f Creinhardtii_281_v5.0.fa.gz -g Creinhardtii_281_v5.5.gene.gff3.gz -l Gene_shortlist.txt -w Bac_wells.txt -o Chlamydomonas_BACSearcher_results

Where BACs_fosmids.pairs.tsv refers to precursor file I (below); Creinhardtii_281_v5.0.fa.gz refers to precursor file II; Creinhardtii_281_v5.5.gene.gff3.gz refers to precursor file III; Gene_shortlist.txt refers to precursor file IV; and BAC_wells.txt refers to precursor file V. Chlamydomonas_BACSearcher_results is the output file name.

1.4. Required precursor files

• Precursor file I

  TSV file containing the coordinates of the start and end of each valid BAC in the library. The file contains start and end coordinates for all valid BACs and fosmids within the Chlamydomonas BAC library, as well as the lengths of each. BACs are identified by a PTQ number and fosmids are identified by a VTP number. Plasmids are defined as valid if their start and end sequences are mapped to the same chromosome, with one end mapped to the sense strand and the other to the anti-sense strand. These criteria exclude 3179 of the 11,676 BACs (27.2%) and 20,696 of the 56,276 fosmids (36.8%) that are annotated against the Chlamydomonas genome (v5.5). Due to the way the BACs have been annotated against the genome, some valid plasmids have more than two ends mapped to the same chromosome and so are represented more than once. This file is provided in the repository as BACs_fosmids.pairs.tsv.

• Precursor file II *

  Zipped FASTA file (Creinhardtii_281_v5.0.fa.gz) containing the gene sequences for all Chlamydomonas nuclear genes. This file is not provided in the repository and can be downloaded from Phytozome>PhytozomeV12>Creinhardtii>assembly.

• Precursor file III *

  Zipped GFF file (Creinhardtii_281_v5.5.gene.gff3.gz) containing version 5.5 annotation information for the Chlamydomonas genome. This file is not provided in the repository and can be downloaded from Phytozome>PhytozomeV12>Creinhardtii>annotation.

• Precursor file IV (Optional)

  TXT file containing the Cre IDs for all genes of interest to be processed, one per line, each appended with ‘.v5.5’. If this file is not provided, BACSearcher will process all nuclear genes and produce a TSV file of the results with the name specified by -o (see Example usage, above).

• Precursor file V

  TXT file containing the plate and well coordinates of each BAC in the library, in the format ‘A-B-C’, where A is the plate number, B the row number and C the column number. This file is provided in the repository as BAC_wells.txt.

• Precursor file VI (Optional)

  DB file generated from III using the BACSearcher script, which can be used in place of III in future runs.

* Genome FASTA and gene annotation GFF files (precursors II and III) are available for download from Phytozome, entitled Creinhardtii_281_v5.0.fa.gz and Creinhardtii_281_v5.5.gene.gff3.gz. The output provided in Supplemental Data Set 1 of the associated manuscript used precursor files II and III downloaded from Phytozome V12.

When supplied with a GFF file via -g, BACSearcher will generate a gffutils database for the GFF file (precursor file VI). BACSearcher can also use this database directly with the -d option, saving the effort of regenerating the database.

1.5. Modifications to the script

The BACSearcher output for all 17,741 Chlamydomonas genes is provided in Supplemental Data Set 1 of the associated manuscript according to default parameters described in the Function section, above. Users can modify the script to change the length or position of the homology regions that BACSearcher reports, as well as the region that reported BACs should cover for each gene. These modifications are made by adding the additional options -q, -r, -s, -t, -u and -v to the command line before running the script.

1. Modifying the lengths of the homology arms:

   By default, BACSearcher reports 5’ and 3’ homology regions for each gene that are 50 bp long. To change these lengths to a different value, x, the options -q and -r can be added to the command line:

   -q x will change the default lengths of the reported 5’ homology regions to an integer, x bp.

   -r x will change the default length of the 3’ homology region to an integer, x bp.

   We recommend using the same values for -q and -r.

2. Modifying the size of the upstream native promoter region:

   By default, BACSearcher searches for 5’ homology regions 2000-3000 bp upstream of the start codon. To change the searched region, the default maximum flank of 3000 can be changed to a different value, x, by adding the option, -s, to the command line:

   -s x will direct the script to search for suitable homology regions in the 1000 bp downstream of an upstream position, x bp. For example, if x=5000 the script will search for regions between 4000 and 5000 bp upstream of the start codon of each gene.

   If you would like to measure from the start of the 5’UTR instead of from the start codon, the option -u can be added to the command line:

   -u will direct the script to search for homology regions in the region defined by -s but measured from the 5’UTR instead of the start codon. If -u is used but -s is left undefined, the script will search for homology regions 2000-3000 bp upstream of the 5’UTR.

3. Modifying the BACs reported for each gene:

   By default, the script is set to report BACs that cover the coding region plus the upstream flank for each gene, ignoring the 3'UTR. The upstream flank is defined by -s and -u (see (2), above) with a default value of 3000 bp upstream from the start codon. If you would like to add a downstream flank of length x bp that any reported BACs should also cover, the option -t can be added to the command line:

   -t x will direct the script to report only those BACs that cover x bp downstream from the stop codon of each gene. If you would like to measure the downstream flank from the end of the 3’UTR instead of from the stop codon, the option -v can be added to the command line:

   -v will direct the script to report BACs that cover a downstream region defined by -t but measured from the 3’UTR instead of from the stop codon of each gene. If -v is used but -t is left undefined, the script will report BACs that cover up to the 3’ end of the 3’UTR.

2. Output sorters for genome analysis programs

Developed by Tom Emrich-Mills

2.1. Tandem Repeats Finder output sorter

Python script intended for processing the output information produced by Tandem Repeats Finder (Benson, 1999) into CSV format. Usage instructions are included at the top of the script: TRF-output-sorter.py

2.2. Primer3 check_primers output sorter

Python script intended to enable quick analysis of the output from the Primer3 check_primers module (Rozen and Skaletsky, 2000). Usage instructions are included at the top of the script: Check_primers-output-sorter.py

2.3. WindowMasker output sorter

Python script intended for counting the number of repeat sequences masked by WindowMasker (Morgulis et al., 2006). The script takes the interval TXT file produced by WindowMasker and outputs a CSV file containing the number or repeats per input sequence. Usage instructions are included at the top of the script: WindowMasker-output-sorter.py