nextflow.config

params {

  //input reads, sample name. Can also be specified in bash
  read1 = 'NG-A7018_lasbox_libLAU7140_libLAV4751_1.fastq.gz'
  read2 = 'NG-A7018_lasbox_libLAU7140_libLAV4751_2.fastq.gz'
  sample = 'lasbox'

  // FASTA file containing barcode sequences
  // barcodes must be anchored (i.e., ^ at beginnging of each)
  // Barcodes are assumed to be 5' inline barcodes
  barcodes_fasta = 'barcodes_anchored.fasta'

  // 3' anchor sequence used to orient merged reads with cutadapt, around 20-25bp is good
  // Typically the reverse complement of reverse primer or a constant downstream sequence
  // NOTE: '$' anchors the match to the end of the read
  orient_3p_anchor = 'GATCTATGAGCAAAGGAGAAGAAC$'

  // Left flanking sequence immediately upstream of the library region (41bp)
  // Full promoter sequence through EcoRI site; used to exclude reads with mutated promoters
  left_flank = 'TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCGAATTC'

  // Right flanking sequence immediately downstream of the library region (25bp)
  right_flank = 'GGATCCAGCTGTCACCGGATGTGCT'

  // Expected length (bp) of the extracted library region
  // Target is 20bp; allow ±1bp
  lib_min_len = 20
  lib_max_len = 20


  //parameters below you can likely leave

  // Minimum required overlap (bp) when matching flanking regions
  // Updated to match 41bp left flank length
  extract_overlap = 41

  // Absolute mismatch allowance for the cutadapt extract step
  // Set to 0: exact match required on both left and right flanks
  cutadapt_e = 0

  // Error rate for cutadapt orient step (applies to 10bp barcodes + 3p anchor)
  // Can safely increase to 0.20 for orient IF min barcode distance >= 5
  // At 0.15: 1 mismatch allowed on 10bp barcodes (safe with min distance 4)
  cutadapt_e_orient = 0.15

  // Error rate for cutadapt demux step - keep conservative
  // At 0.15: 1 mismatch allowed. Do NOT increase to 0.20 unless min barcode distance >= 5
  // (current barcodes have 6 pairs at distance 4, which would risk miscalls at 0.20)
  cutadapt_e_demux = 0.15

  // Minimum overlap required to merge paired-end reads
  flash_min_overlap = 20

  // Maximum overlap allowed when merging reads
  // Should be >= expected insert size
  flash_max_overlap = 250

  // Maximum mismatch density allowed in overlap region
  flash_mismatch = 0.1

  // Phred quality encoding (usually 33 for Illumina)
  flash_phred = 33

  // Number of CPU cores to use
  cpus = 8
  outdir = 'results'

  // Set to false to preserve work/ directory for -resume
  cleanup = true

  // Output counts of whole demuxed reads (useful for downstream extraction in R)
  count_whole_reads = true

  // Output counts of extracted library region only
  count_library = true

}


// Auto-clean work/ on successful completion; set to false to preserve for -resume
cleanup = params.cleanup

process {
  executor = 'local'
}

profiles {
  conda {
    conda.enabled = true
    conda.autoActivate = true
    process.conda = "${projectDir}/environment.yml"
  }
}