I used motifbreakR to score some variations (including indel), but the program reported an error. I found that it was due to the problem of the scoreSnpLst function in motifbreakR,
seq.remove <- ref.len - alt.len; if (seq.remove < 0) { ref.range <- ref.range[1:(length(ref.range) + seq.remove)]; }else { alt.range <- alt.range[1:(length(alt.range) - seq.remove)]; }
The ref allele of a problem variant is 'GCCACCAATACCTACATAAATCAAAAGAAATAAAACATCCAACAACCACTGGATTCA' , and the alt allele is 'ACTGTTAAATGCCA', thus the seq.remove equal 43. The length of the alt.range equal 34, thus length(alt.range) - seq.remove get an negative value and caused error. It seems that this indel is too large, and the length difference between ref and ALT is too large.
I am confused about how large indels can motifbreakR process. Could you please give some suggestions?
I used motifbreakR to score some variations (including indel), but the program reported an error. I found that it was due to the problem of the
scoreSnpLstfunction inmotifbreakR,seq.remove <- ref.len - alt.len; if (seq.remove < 0) { ref.range <- ref.range[1:(length(ref.range) + seq.remove)]; }else { alt.range <- alt.range[1:(length(alt.range) - seq.remove)]; }The ref allele of a problem variant is 'GCCACCAATACCTACATAAATCAAAAGAAATAAAACATCCAACAACCACTGGATTCA' , and the alt allele is 'ACTGTTAAATGCCA', thus the
seq.removeequal 43. The length of thealt.rangeequal 34, thuslength(alt.range) - seq.removeget an negative value and caused error. It seems that this indel is too large, and the length difference between ref and ALT is too large.I am confused about how large indels can motifbreakR process. Could you please give some suggestions?